1 a tour of ruby

The Art of R Programming: A Tour of Statistical Software Design ppt

... Data Frames A typical data set contains data of different modes In an employee data set, for example, we might have character string data, such as employee names, and numeric data, such as salaries ... by reading in a data set from a ﬁle or database We’ll talk more about data frames in Chapter 1.4.6 Classes R is an object-oriented language Objects are instances of classes Classes are a bit ... project, I made a very rough (and very partial) draft of the book available for public comment and received helpful feedback from Ramon Diaz-Uriarte, Barbara F La Scala, Jason Liao, and my old...

404
1,997
0

Chapter 6- A Tour of the Cell pps

Danh mục: Điện - Điện tử

... eukaryotic cell has internal membranes that partition the cell into organelles • Plant and animal cells have most of the same organelles BioFlix: Tour Of An Animal Cell BioFlix: Tour Of A Plant Cell ... critical • As the surface area increases by a factor of n2, the volume increases by a factor of n3 • Small cells have a greater surface area relative to volume Copyright © 2008 Pearson Education, ... or eukaryotic(nhan thuc) • Only organisms of the domains(pham vi,linh vuc) Bacteria and Archaea consist of prokaryotic cells • Protists(sinh vat don bao), fungi(nam), animals, and plants all consist...

124
5,289
1

Unit 1 : A visit of a pen pal - Period 3: READ

Danh mục:

... table: Area: 329,758 Population: Over 22 million Tropical climate Climate: Unit of currency: The ringgit Capital city: Kuala Lumpur Islam Official religion: National language: Bahasa Malaysia ... PETRONAS TWIN TOWERS Ms Minh Thu Unit : A visit of a pen pal Period 3: READ Ms Minh Thu Matching Countries in Asian Capital Viet Nam Bangkok Indonesia Yangon Malaysia Jakarta The Philippines Bandar ... language: Ms Minh Thu True / False statements: Malaysia is a member country of ASEAN T There are two religions in Malaysia F There are more than two religions People speak only Malay in Malaysia...

Universe a grand tour of modern science Phần 1 pptx

Danh mục: Khoa học xã hội

... same condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloguing in Publication Data Data available Typeset in 11/13pt Dante by SPI Publisher ... making an exactly equal amount of antimatter at the same time And there’s the problem If the Universe made equal amounts of matter and antimatter, it should all have disappeared again, in mutual annihilation, ... they annihilate each other and disappear in a puff of gamma rays This happens night and day, above our heads, as cosmic rays coming from our Galaxy create positrons, and electrons in the atmosphere...

Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 1

Danh mục: Thạc sĩ - Cao học

...

Unit 1: A day in the life of. Listening

Danh mục: Tiếng anh

... WARM UP Game: JUMBLED WORDS CCLOY  CYCLO RIEDV  DRIVE TALLS DOFO  FOOD STALL NSSEGERPA  PASSENGER PRE-LISTENING WHO IS HE? - He gets up very early - He has got a cyclo - He usually has meals ... Listen and order these pictures WHILE-LISTENING Listen again and decide whether the statements are True (T) or False (F) Mr Lam lives in District Mr Lam usually gets up early After Mr Lam gets ... to District Mr Lam’s first passengers are two pupils Mr Lam has lunch at home with his family After lunch Mr Lam immediately goes back to work T F POST-LISTENING V HOMEWORK - T asks ss to remember...

10
12,613
39

Unit 1-A day in the life of...

Danh mục: Tiếng anh

... A day in the life of Period 4: Writing Task Task 3.Task 3: Example: Last year/ I / spend / summer holidays / a seaside town Last year, I spent my summer holidays at a seaside town Unit 1: A ... Read the passage and find all the verbs that are used in past simple and the connectors in the story Simple past Regular verbs land stare announce Irregular verbs take begin S + Ved landed stared ... 1: A day in the life of Last year, I spent Period 4: Writing at a my summer holidays seaside town The hotel was modern and Task comfortable I had a wonderful holiday until the fire Task Task...

20
2,807
5

A Quick Tour of the C++CLI Language Features

Danh mục: Kỹ thuật lập trình

... mean that they had no implementation Even so, such a class is not quite the same as an interface An interface class has no fields and no method implementations; an abstract base class may have ... Version of Heisenberg Uncertainty void atoms() { int n_atoms = 50; array^ atoms = gcnew array(n_atoms); // Between the array creation and initialization, // the atoms are in an invalid ... inheritance We could create a RadioactiveIon class that inherits from both Ion and RadioactiveAtom But we can’t that in C++/CLI (at least not in a managed type) because in C++/CLI managed types are...

A Brief Tour of the X Display Environment

Danh mục: Kỹ thuật lập trình

... on a laptop and the X application (i.e., client) that you want to run is located on a remote system You can arrange to have the application output display on the laptop The following paragraphs ... Sometimes application owners may need root access on a system, such as when applications that are owned and managed by someone other than the administrator need to run as root because of their ... that authorization for Machine C to connect to the display on Machine A is in place, the last task is to set the DISPLAY variable for the X client on CHAPTER 21 ■ A BRIEF TOUR OF THE X DISPLAY...

Gián án Ụnit 1: A day in the life of...

Danh mục: Tư liệu khác

... Linh’sdaily routine -Do you have a daily routine? -is it same or different from Linh? 5ms 2.Pre-task: BRAIN STORM -ask ss think about some their activities in a day in m -after m t call on some ss and ... and ask them about their activities: T: Lan, what time you often get up? Lan:: I often get up at 6.oo T: Phong, what you often in the afternoon? Phong: I go to school T: Hoa, what time you often ... Stage / timing Prereading 5ms Activities warm-up GUESS THE ACTIVITIES * Instruction: -Divide class in to two teams: team A & team B -Show a video about linh’ daily routine in minute -ask ss...

3
2,111
12

CHAPTER 1 Microeconomics, A Way of Thinking about Business

Danh mục: Chuyên ngành kinh tế

... better off Harry can produce papayas, giving up coconut, and trade of the papayas for a coconut He has the same number of coconuts, but has an additional papaya Harry is better off Although relatively ... the attainment of material goals Although most economic principles have to with the pursuit of material gain, they can be relevant to aesthetic and humanistic goals as well The appreciation of a ... problem is basically involved in our analysis of the fragile nature of Fred and Harry’s social contract Fred and Harry’s situation is a classic example of what social scientists call a “prisoner’s...

Tài liệu Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 1) doc

Danh mục: Sức khỏe giới tính

... Medicine, Hamamatsu University School of Medicine, Hamamatsu Kazuichi HAYAKAWA Graduate School of Natural Science and Technology, Kanazawa University, Kanazawa Yoko HIEDA Department of Legal Medicine, ... Drugs and Poisons in Humans A Handbook of Practical Analysis Osamu Suzuki and Kanako Watanabe Drugs and Poisons in Humans A Handbook of Practical Analysis With 236 Figures and 90 Tables 123 Prof ... Chiba Yasuhiro SUZUKI National Research Institute of Police Science, Chiba Nariaki TAKAYAMA Forensic Science Laboratory, Ishikawa Prefectural Police Headquarters, Kanazawa Tatsunori TAKAYASU...

Learning english is a piece of cake 1

Danh mục: Kỹ năng nói tiếng Anh

... difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a piece of cake ənd ... Don’t worry about pronunciation Don’t worry about grammar doʊnt ˈwɝːɪ ə ˈbaʊt prə ˌnʌnts i ˈeɪʃ ən doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ...  In fact, she is a sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ...

2
1,669
15

Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Danh mục: Kĩ thuật Viễn thông

... resultant force is to be F1, directed along the keel aa as shown, determine the magnitudes of forces T and P acting in each rope and the angle θ of P so that the magnitude of P is a minimum T acts ... Chapter Problem 1-19 Evaluate each of the following to three significant figures and express each answer in SI units using an appropriate prefix: (a) a 1/b1, (b) a2 b2/c2, (c) a3 b3 Units Used: μm ... Mechanics - Statics Chapter Problem 1-16 Two particles have masses m1 and m2, respectively If they are a distance d apart, determine the force of gravity acting between them Compare this result...

1,119
1,071
2

Tài liệu A History of Indian Philosophy, Vol. 1 pptx

Danh mục: Cao đẳng - Đại học

... Taittirîya and Mahânâraya@na, of the Ka@tha school the Kâ@thaka, of the Maitrâya@nî school the Maitrâya@nî The B@rhadâra@nyaka Upani@sad forms part of the S'atapatha Brâhma@na of the Vâjasaneyi ... 16 Brahmabindu, 17 Ha@msa, 18 Âru@nika, 19 Garbha, 20 Nârâya@na, 21 Nârâya@na, 22 Paramaha@msa, 23 Brahma, 24 Am@rtanâda, 25 Atharvas'iras, 26 Atharvas'ikhâ, 27 Maitrâya@nî, 28 B@rhajjâbâla, 29 ... This again had another commentary called _Varddha-mânendu_ upon it by Padmanâbha Mis'ra, and this again had another named _Nyâya-tâtparyama@n@dana_ by S 'a@ nkara Mis'ra The names of Vâtsyâyana,...

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Danh mục: Báo cáo khoa học

... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... C19 9A mutations of Shh were introduced by PCR using primers 5¢-CCTGCAGCAGCGGCAGGCA AGGTTATATAG-3¢ and 5¢-GGGCCCAGAGGCCAGG CCGGGGCACACCAG-3¢, and primers 5¢-GGCATGC TGGCTCGCCTGGCTGTGGAAGCA-3¢ and ... indicate that both palmitoylated and nonpalmitoylated mammalian Hh proteins can act as signaling molecules It is notable that while cholesterylation of Hh protein is an intramolecular event catalyzed...

Tài liệu The Days of Bruce Vol 1 A Story from Scottish History ppt

Danh mục: Khoa học xã hội

... great appearance of zeal, the guardianship of the young Earl of Fife and his sister, an office bequeathed to him under the hand and seal of the earl, his nephew The character of the Lady Isabella ... couch of disease, and rode his war-horse with all the grace and ease of former years A gallant army, under the command of Aymer de Valence, Earl of Pembroke, had already been dispatched towards ... live and die with him against all manner of men Athol, Fraser, Seaton, Douglas, Hay, gladly and willingly followed his example; and it was curious to mark the character of each man, proclaimed...

Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx

Danh mục: Báo cáo khoa học

... exchange on eukaryotic initiation factor Nature 296, 93–95 Sudhakar A, Krishnamoorthy T, Jain A, Chatterjee U, Hasnain SE, Kaufman RJ & Ramaiah KV (1999) Serine 48 in initiation factor alpha (eIF2 ... (BioSource, Camarillo, CA, USA), total eIF 2a (Santa Cruz Biotechnology, Santa Cruz, CA, USA), total yeast eIF 2a (gracious gift of T E Dever, National Institutes of Health, Bethesda, MD, USA) or Nck [33], ... illustrated by the increased translation of the activating transcription factor (ATF4), a transcription factor that initiates a transcriptional program increasing the expression of speciﬁc products...

Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Danh mục: Báo cáo khoa học

... PCR ampliﬁcation of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG ... 95–104 Kaya H, Shibahara KI, Taoka KI, Iwabuchi M, Stillman B & Araki T (2001) FASCIATA genes for chromatin assembly factor-1 in Arabidopsis maintain the cellular organization of apical meristems ... topoisomerase II interacts with Lim15/Dmc1 in meiosis Nucleic Acids Res 33, 5809–5818 Koshiyama A, Hamada FN, Namekawa SH, Iwabata K, Sugawara H, Sakamoto A, Ishizaki T & Sakaguchi K (2006) Sumoylation...

Xem thêm

Bạn có muốn tìm thêm với từ khóa:

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008